Multispectral Bacterial Identification
Michael A. Tanner* , William J. Coleman, Christine L. Everett, Steven J. Robles, Michael R. Dilworth, Mary M. Yang, and Douglas C. Youvan
Kairos Scientific Inc., Bldg., 62, 3350 Scott Blvd., Santa Clara, CA 95054
ABSTRACT
A multispectral optical technique was developed to simultaneously classify individual bacterial cells within mixed populations. Multispectral Bacterial Identification (mBID) combines innovations in microscopy with a software analysis program to measure and categorize the fluorescence signals from multiplexed 16S ribosomal RNA probes hybridized to populations of different bacteria. Software was developed to identify individual bacteria at the level of species within these mixed populations. To test the feasibility of mBID, we examined the fluorescence emissions from a mixture of probes specific for individual species of known bacteria from the American Type Culture Collection (ATCC). Currently, up to seven species can be detected simultaneously by fluorescence microscopy. An eighth signal was reserved for a universal probe to control for fluorescence intensity. mBID can also be used to identify uncultured microorganisms. We plan to couple this new multispectral technology to existing identification technologies that utilize 16S rRNA sequence alignment. Using this integrated identification protocol, bacteria that may be associated with chronic conditions (e.g., prostatitis and vaginosis) will be identified first by analyzing their 16S rDNA sequences and then by visualizing them with fluorescent probes hybridized to their 16S rRNA in situ.
Keywords: 16S rRNA, Bacteria, fluorescence microscopy, phylogeny, probes, vaginosis.
1. INTRODUCTION
Bacterial identification by a variety of methods has become an essential diagnostic tool in areas such as healthcare, food and water quality testing, and enzyme discovery (Amann et al., 1992; OHara et al., 1993; Vandamme, E.J., 1994; Birnbaum et al., 1994; Vandamme, P., 1996; Relman, 1998; Schrenk et al., 1998). Traditionally, microbiologists performing bacterial identification have relied on cultivation of organisms, despite the realization that most of them (>99%) are not cultivable by standard methods (Amann et al., 1995; Pace, 1997; Head et al., 1998; Hugenholtz et al., 1998). More recently, molecular methods have been developed to examine the diversity of microorganisms without the need to isolate or culture them. One class of methodology takes advantage of the conserved nature of protein synthesis in all cellular organisms. With about 10,000 partial or complete sequences now available for comparison, the small subunit 16S ribosomal RNA (rRNA) is currently the molecule of choice for identifying bacteria and other microorganisms at the species level. Molecular strategies based on PCR, cloning, sequencing, and probing have enabled biologists to examine the total bacterial community in a sample without any a priori knowledge of the species present in the mixture (Amann et al., 1995). Although rRNA-based ID is only accurate to approximately the level of species, its tremendous versatility makes it extremely valuable for high-throughput screening and identification of microorganisms.
The information gained from 16S rRNA gene sequence comparisons can be used to deduce detailed phylogenetic relationships based on evolution. An evolutionary distance map generated from 16S rRNA gene sequence data highlights the major lineages of Bacteria and Archaea (Figure 1). The highly conserved portions of 16S rRNA genes are ideal for designing primers that will amplify small subunit rRNA genes from all three domains of life (Bacteria, Archaea, and Eucarya). At the other extreme, primers can be designed to highly variable regions of 16S rRNA genes and thus amplify only a particular species or genus in a mixture of microorganisms. Likewise, fluorescent DNA hybridization probes based on 16S gene sequencing can be constructed to identify organisms in a large group (e.g., phylum) or in a localized group (e.g., genus), depending on whether the probe sequence is complementary to a conserved or variable region of the 16S rRNA, respectively. Probes can be covalently labeled with fluorophores to enable in situ hybridization and identification by fluorescence imaging microscopy (Amann et al., 1990). Ribosomal RNA is a particularly convenient and attractive hybridization target for quantitative microscopy because a typical E. coli cell contains approximately 20,000 ribosomes (Neidhardt, 1987), and thus ~20,000 copies of the target sequence.

Figure 1. Phylogenetic tree of the three domains of life (Bacteria, Archaea, and Eucarya) based on the evolutionary distance of the 16S rRNA molecule (adapted from Barns et al., 1996). Members of the Eucarya are omitted for clarity. The genera listed are representative of major lineages of the two domains. Bootstrap values indicate the percentage of trees that resulted in the branching order shown. Two different treeing algorithms, maximum likelihood and maximum parsimony, generated these values. Environmental sequences are known only from their 16S rRNA gene. Note that although the arrangement of the branches on the tree may change as new information is gathered, this does not affect the accuracy of using a unique 16S rRNA gene sequence to identify a particular organism.
PCR has been an extremely powerful tool for analyzing samples and constructing databases of sequences. It has been used to amplify the 16S rDNA from microorganisms isolated from highly diverse and extreme environments, as well as from clinical sources (Hugenholtz et al., 1998; Relman, 1998). Unknown organisms are being identified at the level of new phyla, expanding on the bacterial line of descent. Many of these new phyla do not have cultured representatives, and yet PCR analysis indicates that they are abundant in the environment. These organisms are completely novel, and they may be a rich source of new antibiotics, enzymes, and other bioactive compounds for medicine and biotechnology (Short, 1997; Rondon et al., 1999). Recently, attempts have been made to reduce the sequencing load and to increase the screening throughput by employing restriction fragment length polymorphism (RFLP) analysis to examine the diversity of these microbial populations. To design actual probes however, a full length 16S rRNA sequence is needed, and it must be aligned into an existing database.
As we noted above, the etiology of human infections has historically relied on cultivation to identify the responsible microorganisms. Isolation and inoculation of cultured microbes is the conventional means to link causation of disease to a particular pathogen i.e., Kochs Postulates. However, microbes that are difficult or impossible to culture with current techniques can cause some human clinical syndromes that were originally thought to be nonmicrobial. Indeed, a number of pathological conditions are known to be the result of uncultivated bacteria (Fredricks & Relman, 1996; Lorber, 1996). A few examples in which molecular methods have been used to identify uncultured bacteria have been reported. The causative agent of Whipples disease, for instance, is resistant to culture, but can be identified using PCR and 16S rRNA gene sequence analysis (Relman et al., 1992). Additionally, the PCR approach has been used to identify the Whipple bacillus (Tropheryma whippelii) in the eye and mononuclear cells of blood (Rickman et al., 1995; Müller et al., 1993). Similarly, the etiologic agents of cat scratch disease and bacillary angiomatosis were identified using PCR and 16S rRNA analysis (Adal et al., 1994). Sequence analysis identified the agent as a member of the genus Rochalimaea (Proteobacteria; alpha subdivision).
The difficulty of cultivation also has led to the realization that many human infections are more complex than originally thought. The common expectation of syntrophy, where one organism is dependent on the metabolism of another frequently observed in the environment may be prevalent in the diseased state as well. Biofilms are a good example of microbial communities, and they have caught the attention of biomedical science, since microbial communities existing as biofilms play a role in both human health and disease. Bacteria that form these biofilms are well known in tooth decay and artificial implants, and are now implicated in other diseases, including kidney, urinary tract and ear infections. Individual species of bacteria in a community may be dependent on other species for survival, which makes isolation in culture a formidable task. Likewise, analyzing such communities in situ using the currently available methods is a difficult undertaking.
Evidence for a complex bacterial population in a disease condition was recently described for prostatitis, a common disease in adult men of all ages (Tanner et al., 1999). Frequently, patients are diagnosed with 'nonbacterial' prostatitis, but some of these patients respond to antibiotic treatment and show evidence of distinct bacterial species by molecular techniques, despite the absence of cultivable bacteria (Tanner et al., 1999). These species were identified by phylogenetic analyses of their 16S rRNA gene sequences from mixed populations. Prostatitis is an appropriate model to study bacterial identification by multispectral imaging because various bacterial species are present, including some that are uncultured, and samples are easy to acquire and process. A second disease amenable to study by mBID is bacterial vaginosis, a prevalent disorder that is probably the result of an imbalance in the various bacterial populations that comprise the vaginal flora. Interestingly, biofilms may play a significant role in the pathology of prostatitis and vaginosis, contributing to the lack of cultured microorganisms in many patients (Potera, 1999).
For in situ analysis of these bacterial species, the information gained from PCR and sequencing can be advantageously exploited to synthesize fluorescently labeled oligonucleotide probes for direct hybridization against the 16S rRNA. Up to now, however, these in situ hybridization experiments have utilized no more than one or two probes per sample because of the lack of adequate instrumentation. The ability to employ multiple probes simultaneously and to analyze them with a radiometrically-calibrated system will increase the amount of information that can be obtained from a given sample and substantially increase the overall throughput. In addition, the analysis can be performed on single cells, without extracting, purifying, and amplifying the nucleic acids each time. A whole-cell in situ method such as mBID has numerous advantages over other bacterial ID techniques, including:2. METHODS AND RESULTS
2.1 Selecting 'test targets' for instrument developmentAfter searching the scientific literature and the rRNA phylogenetic databases, we selected a set of approximately two dozen well-characterized, nonpathogenic bacterial and archaeal species that were used in the initial mBID hybridization studies. This particular set of species provides diverse 'targets' from many different taxa, including the Archaea, several members of the Proteobacteria, the Low G+C gram-positive bacteria, and Actinobacteria (High G+C gram-positive bacteria). In Table 1, we list specific probe sequences and fluorescent dye labels used to ID one particular set of seven bacterial species. Sixteen other species-specific probes have also been designed (including probes against members of the domain Archaea), and a series of analogous species-specific ID experiments have been successfully performed (data not shown).
Probe Sequence |
Species Specificity / Phylum or Subdivision |
Channel |
Dye |
| CCACTGCCTTTTACACCAGA | Lactococcus lactis/ Low G+C gram positive |
1 |
Alexa 350 |
| AACTTTACTCCCTTCCTCC | Escherichia coli/ g Proteobacteria |
2 |
Pacific Blue |
| CCGCGGC(T/G)GCTGG | All (Universal) |
3 |
Bodipy 493/503 |
| GCCCTTTGTTCTGT | Bacillus subtilis/ Low G+C gram positive |
4 |
Bodipy R6G |
| ACCGCCCCAAAAGGAGAAACCACA | Arthrobacter globiformis/ Actinobacteria |
5 |
Bodipy 564/570 |
| ACCAGTTGACATCGTTTAGGGC | Leptothrix discophora/ b Proteobacteria |
6 |
Bodipy 581/591 |
| ATCCAGGTACCGTCACCTTAA | Corynebacterium flavescens/ Actinobacteria |
7 |
Cy5 |
| ACAACCCATAGGGCAGTCT | Flexibacter maritimus/ *BCF |
8 |
Cy5.5 |
Table 1. Probe sequences for selected bacteria used to test species-specific hybridization in an eight-channel experiment. One channel (Channel 3) was reserved for a universal probe, whereas the remaining seven channels are each designed to identify a particular species with the corresponding probe.
2.2 Imaging Spectroscopy and mBID
One of the most challenging engineering problems in mBID is to spectrally separate and quantitate many different fluorescent tags within a complex mixture while maintaining pixel-resolution (spatial) image registration. In addition, the mBID imaging spectrophotometer requires the spatial resolution of an epifluorescence microscope (<1 µm) and the spectral resolution of a conventional fluorimeter (~5 nm). To meet these engineering goals, we have replaced the fixed-wavelength excitation and emission filters of a conventional epifluorescence microscope (Olympus AX80) with a large number of discrete excitation filters and a fully tunable emission filter, respectively. This tunable filter consists of a computer-interfaced Circular Variable Interference Filter (CVIF) to select the emission wavelength, and thus it allows us the flexibility of choosing any desired wavelength between 400 and 700 nm. Because of the extreme surface parallelism of the CVIF, we have been able to achieve sub-pixel image registration which is not usually feasible with a set of conventional emission filters. In addition, signal-to-noise considerations in fluorescence microscopy demands an epifluorescence configuration; therefore, we incorporated a programmable 8-position turret (containing dichroic mirrors) into the mBID instrument. To achieve intense monochromatic illumination, we have also adapted a stepper-driven, dual-wheel excitation filter set (carrying 18 bandpass filters) to the epi-illumination optics of the AX80.
2.3 Fluorophores and Optical Filters
Fluorescent dyes were selected so as to minimize spectral overlap among channels, provide simple coupling reactions to DNA probes, and maintain high quantum yields with low photodestruction. Each fluorophore / channel combination was optimized with respect to the wavelength of maximum transmission and bandpass for the excitation and emission filters, and the cut-on for the dichroic beamsplitter. Typically, the excitation filter for a particular dye is placed close to the dye's excitation maximum while minimizing the excitation of the next bluest and next reddest dyes. The dichroic filter is set slightly to the blue of the midpoint between the excitation and emission maximum of the dye, while the narrow bandwidth CVIF is positioned as close as possible to the emission maximum.
The optimization of mBID's filters-to-fluorophore set is essential in reducing light dose and photodestruction as well as spectral overlap. Our original Fluorescence Imaging MicroSpectrophotometer (FIMS) configuration (Youvan et al., 1997) is not optimized for any particular set of dyes, since it performs full-spectrum excitation and emission scans. Thus the mBID configuration, using discrete excitation filters, a set of 8 dichroic filters, and a full spectrum CVIF, is unique. Five optical parameters were optimized simultaneously for each channel summarized in Table 2: two parameters are specified for each excitation filter (wavelength of maximum transmission and bandwidth); two parameters are specified for each dichroic filter (inflection point of the transmission cut-on and out-of-band light transmission characteristics); one parameter is specified for the wavelength of maximum transmission of the CVIF.

2.4 Probe Hybridization
Whole cell in situ hybridization is typically carried out by immobilizing cells on gelatin-coated slides after they have been fixed and permeabilized. The probe solution is then added to the slide and incubated for 2-15 hours at a temperature that is determined by the melting temperature (Tm) of the oligonucleotide DNA probe / rRNA duplex. After hybridization, slides are washed and then mounted in an antifade reagent (Amann et al., 1990; DeLong et al., 1989; Rice et al., 1997). To facilitate high throughput of mBID samples, we have also developed a micro-volume hybridization protocol that can be performed in microcentrifuge tubes or microplate trays. This procedure is analogous to conventional methods with the exception that the cells are fixed, permeabilized, hybridized, and washed in suspension. [Bacteria are collected by a brief, low speed centrifugation step.] In addition to being more amenable to automation and robotic handling, another advantage of hybridization in suspension is that it prevents the loss of cells, such as coccoid bacteria, which adhere poorly to slides. This will be critical for accurately enumerating cells within complex bacterial populations. Micro-volume hybridization is also essential for constructing calibration slides, where it is important to combine bacteria, which have been hybridized in separate reactions, onto a single slide.
2.5 mBID Graphical User Interface
The mBID graphical user interface (GUI) includes multiple window types, wizards, and a number of options pertaining to file management, data acquisition, image processing, and display. It is not a simple operation to visualize and extract useful information from massive amounts of multidimensional data. A schematic of the ultimate mBID GUI which coordinates the display of both spatial and spectral information is depicted in Figure 2.

2.6 Probes to seven cultured bacteria
Figure 3 shows a pseudocolored image of the hybridization pattern of eight probes to the seven species that were described in Table 1. The Contour Plot has been sorted by the channel of maximum intensity into seven groups. The average spectrum for each group has been calculated, and an assigned pseudocolor is associated with the rows in the Contour Plot by the vertical Color-Grouping Bar. Using these pseudocolors, pixels in the image are back-painted. Starting from the leftmost histogram bar in the Plot Window, the intensity of Group 1 in Channel 1 appears as a full-height purple bar corresponding to the upper-left high intensity region of the Contour Plot, where the fluorophore indicative of Channel 1 shows highest intensity. Groups 2 through 7 show no intensity (black) in Channel 1; hence, no other histogram bars are present except for a short bar associated with Group 8 (encoded in red). Moving further to the right in the Plot Window, we see a total of eight groupings of seven vertical bars for each of the eight Channels a total of 56 histogram bars.

3. SUMMARY
Using mBID technology, we have demonstrated the feasibility of simultaneously identifying seven different bacterial species in the same sample. In combination with control experiments that used single probes (not shown), the results shown in Figure 3 demonstrate that it is possible to separate the spectral signals from eight different fluorescent probes, correct for spectral overlap, and back-color each different species. Data presented in Figure 3 have also been normalized based on a universal probe (Channel 3), which corrects the channels for any differences in the number of ribosomes per cell. Successful demonstration of probe specificity and sensitivity was achieved with general and specific probes to bacteria. Finally, it should be noted that the spectra have been automatically sorted using the Contour Plot, and this enabled us to 'backpaint' the bacteria in the image based on their multispectral fingerprint. Thus, the mBID prototype can be used to identify a particular species. Unlike conventional diagnostic procedures that rely on cultivation, mBID has the capacity to analyze unculturable microbes, including those found in clinical samples.
ACKNOWLEDGMENTSThis work was supported by grants R43GM60209 and R43GM60107 from the National Institutes of Health, and by Kairos IR&D funds.
REFERENCES
K. A. Adal, C. J. Cockerell, and W. A. Petri, "Cat scratch disease, bacillary angiomatosis, and other infections due to Rochalimaea," N. Engl. J. Med. 330:1509-1515, 1994.
R. I. Amann, L. Krumholz, and D. A. Stahl, "Fluorescent-oligonucleotide probing of whole cells for determinative, phylogenetic, and environmental studies in microbiology," J. Bacteriol. 172:762-770, 1990.
R. I. Amann, J. Stromley, R. Devereux, R. Key, and D. A. Stahl, "Molecular and microscopic identification of sulfate-reducing bacteria in multispecies biofilms," Appl. Environ. Microbiol. 58:614-623, 1992.
R. I. Amann, W. Ludwig, and K.H. Schleifer, "Phylogenetic identification and in situ detection of individual microbial cells without cultivation," Microbiol. Rev. 59:143-169, 1995.
S. M. Barns, C. F. Delwiche, J. D. Palmer, and N. R. Pace, "Perspectives on archaeal diversity, thermophily and monophyly from environmental rRNA sequences," Proc. Natl. Acad. Sci. USA 93:9188-9193, 1996.
D. Birnbaum, L. Herwaldt, D.E. Low, M. Noble, M. Pfaller, R. Sherertz, and A.W. Chow, "Efficacy of microbial identification system for epidemiologic typing of coagulase-negative staphylococci," J. Clin. Microbiol. 32:2113-2119, 1994.
E. F. DeLong, G. S. Wickham, and Pace, N. R, "Phylogenetic stains: ribosomal RNA-based probes for the identification of single cells," Science 243:1360-1363, 1989.
D. N. Fredricks, and D. A. Relman, "Sequence-based identification of microbial pathogens: a reconsideration of Kochs postulates," Clin. Microbiol. Rev. 9:18-33, 1996.
I. M. Head, J. R. Saunders, and R. W. Pickup, "Microbial evolution, diversity, and ecology: A decade of ribosomal RNA analysis of uncultured microorganisms," Microb. Ecol. 35:1-21, 1998.
P. Hugenholtz, B. M. Goebel, and N. R. Pace, "Impact of culture-independent studies on the emerging phylogenetic view of bacterial diversity," J Bacteriol 180, 4765-4774, 1998.
B. Lorber, "Are all diseases infectious?," Ann. Intern. Med. 125:844-851, 1996.
C. Müller, C. Stain, and O. Burghuber, "Tropheryma whippelii in peripheral blood mononuclear cells and cells of pleural effusion [Letter]," Lancet 341:701, 1993.
F. C. Neidhardt, "Chemical composition of Escherichia coli," In: Escherichia coli and Salmonella typhimurium (Neidhardt, F. C. et al., eds.) Vol 1, pp. 3-6. American Society for Microbiology, Washington, D.C, 1987.
C. M. O'Hara, F. C. Tenover, and J. M. Miller, "Parallel comparison of accuracy of API 20E, Vitek GNI, MicroScan Walk/Away Rapid ID, and Becton Dickinson Cobas Micro ID-E/NF for identification of members of the family Enterobacteriaceae and common gram-negative, non-glucose-fermenting bacilli," J. Clin. Microbiol. 31:3165-3169, 1993.
N. R. Pace, "A molecular view of microbial diversity and the biosphere," Science 276:734-740, 1997.
C. Potera, "Forging a link between biofilms and disease (News Focus)," Science 283:1837-1839, 1999.
D. A. Relman, T. M. Schmidt, R. P. MacDermott, and S. Falkow, "Identification of the uncultured bacillus of Whipples disease," N. Engl. J. Med. 327:293-301, 1992.
D. A. Relman, "Detection and identification of previously unrecognized microbial pathogens," Emerg. Infect. Dis. 4:382-389, 1998.
J. Rice, C. D. O'Connor, M. A. Sleigh, P. H. Burkill, I. G. Giles, and M. V. Zubkov, "Fluorescent oligonucleotide rDNA probes that specifically bind to a common nanoflagellate, Paraphysomonas vestita," Microbiol. 143:1717-1727, 1997.
L. S. Rickman, W. R. Freeman, W. R. Green, S. T. Feldman, J. Sullivan, V. Russack, and D. A. Relman, "Brief report: Uveitis caused by Tropheryma whippelii (Whipples bacillus)," N. Engl. J. Med. 332:363-366, 1995.
M. R. Rondon, R. M. Goodman, and J. Handelsman, "The earths bounty: assessing and accessing soil microbial diversity," Tibtech 17, 383-422, 1999.
M. O. Schrenk, K. J. Edwards, R. M. Goodman, R. J. Hamers, and J. F. Banfield, "Distribution of thiobacillus ferrooxidans and leptospirillum ferrooxidans: implications for generation of acid mine drainage," Science 279:1519-1522, 1998.
J. Short, "Recombinant approaches for accessing biodiversity," Nat. Biotechnol. 15:1322-1323, 1997.
M. A. Tanner, B. M. Goebel, M. A. Dojka, and N. R. Pace, "Specific ribosomal DNA sequences from diverse environmental settings correlate with experimental contaminants," Appl. Environ. Microbiol. 64: 3110-3113, 1998.
M. A. Tanner, D. Shoskes, A. Shahed, and N. R. Pace, "Prevalence of corynebacterial 16S rRNA sequences in patients with bacterial and "nonbacterial" prostatitis," J. Clin. Microbiol. 37: 1863-1870, 1999.
E. J. Vandamme, "The search for novel microbial fine chemicals, agrochemicals and biopharmaceuticals," J. Biotechnol. 37:89-108, 1994.
P. Vandamme, "Polyphasic taxonomy, a consensus approach to bacterial systematics," Microbiol. Rev. 60:407-438, 1996.
D. C. Youvan, W. J. Coleman, C. M. Silva, J. Petersen, E. J. Bylina, and M. M. Yang, "Fluorescence Imaging Micro-Spectrophotometer (FIMS)," Biotechnology et alia, <www.et-al.com>1:1-16, 1997.